Compare Alignment Ver.1

Compare Alignment compares the result of a ClustalW alignment output file for dissimilarities as shown below:
MSV-K .............A C G C A T A
MSV-N .............A C G G A T T
MSV-Z .............T C G C A T A
The output of Compare Alignment is a file that can be imported into Excel that shows the results after the aligned sequences have been compared.

Download software

ORF Extractor

ORF Extractor extracts Open Reading Frames from contigs of any size. ORFs can be extracted in all six frames, and the ORFs length, the start and stop codons can be selected. All ORFs or selected ORFs can be saved and, the sample output file (shown below) can then be used as the input to the Blast program.
>Contig50_6R Forward 2-34, 33
TATTGTTTGAGTTATTT….
>Contig50_10R Forward 639-1433, 795
ATGCAACAGCGAGGTTATAAAGGA….

Download software

Hit Extractor

Hit Extraction parses the Blast output file and extracts a number of hits, defined by the user, for each Fasta entry.
Extracting 1 hit(s) from each FASTA file.
Petunia-C2H4-1-A01.g
gb|AC04.1|F13M7 Arabidopsis thal 50 4e-004
Petunia-C2H4-1-A02.g
GB|L219.1|PETAC Petunia hybrid 31 5e-083
Petunia-C2H4-1-A03.g
*** No Hits Found ***
The text above is a sample of Hit extraction’s output.

Download software

Sequence Order Search, SOS

SOS identifies sense and anti-sense hits in a Blast output file. An example of an output file is shown below: notice the decreasing indices, (63 – 122) and (183 – 242), of the subject sequence
Query: 63 .cacggcgcccgctgctgtggccgg 122
.................||||||||||||||||||||||||||||||
Sbjct: 161 cacggcgcccgctgctgtggccgg 120
Query: 183 cctatcggacgtgttccgtgcca 242
.................|||||||||||||||||||||||||||||
Sbjct: 281 cctatcggacgtgttccgtgcca 240

Download softaware

PexFinder ver.2

PexFinder ver.2 searches the SignalP output file with users defined criteria for specific extracellular signal peptide sequences, and then extracts the files that fulfilled the criteria from the SignalP input Fasta library. The result is a collection of Fasta formatted files, which can be subsequently used in Blast searches. Below is a sample SignalP input with prediction and range bet. 10 and 40:
# Most likely cleavage site between pos. 23 and 24: GEA-LS
SignalP-HMM result:
>PI001E12.XT7.SEQ
Prediction: Signal anchor
Signal peptide probability: 0.008
PexFinder2 Fasta output file:
>PI001E12.XT7.SEQ
MEMSSKIACFIVLCMSKIACFI…

Download software

EleNor

EleNor (Electronic Northern) analyses various EST databases for the frequency of expression of specific genes. Some features of this program are still being developed.

Download softaware